Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YC05FM1
Length(NT) : 263
Best Gene Model Blast : Link to GSTUMT00006093001 E-value : 1e-146
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU06714
Accession: ref|XP_960894.1| Score: 275 E_value: 3e-23
KEGG Definition: hypothetical protein
Accession: ncr:NCU06714.1 Score: 275 E_value: 1e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1224 Score: 273 E_value: 1e-25
PFAM Definition: Chorismate_bind, chorismate binding enzyme. This family includes the catalytic regions of the chorismate binding enzymes anthranilate synthase, isochorismate synthase, aminodeoxychorismate synthase and para-aminobenzoate synthase..
Pfam Number: pfam00425 Score: 206 E_value: 5e-18
Swissprot: O94277|PABS_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0008153 = Biological process: para-aminobenzoic acid biosynthetic process

Sequence:
>SY0AAB11YC05FM1
TTGGAAGACAACATGACAGGATTCGACGTGCTTGCCCGTAGCCTGCCGCC
AGGAAGCATGACCGGCGCGCCGAAGAAACGTAGCGTGGAAATCTTGCAGG
AGATTGAGGAGACGGAGAGAGGGGTTTACAGTGGCGTCTTGGGCTACTGG
AGTGTTTGTGGTGCTGGCGACTGGAACGTGATTATTCGTTCCGCGTTTAG
GTACGACGATGAAGTTGTCACCATGGAGGATGGGGGTGAGAAGGAAGTTT
GGAGGATTGGAGC

Sequences in the Contig:

SY0AAB11YC05FM1