Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YA18FM1
Length(NT) : 558
Best Gene Model Blast : Link to GSTUMT00006231001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG06368.1
Accession: ref|XP_386544.1| Score: 189 E_value: 5e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG06368.1 Score: 189 E_value: 2e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB11YA18FM1
TTGGGCAAACTTCAAGACGAAGAATGGATGGGAAAACTTAACCCTAGATA
CTATCGAACCTAAGGTCGAAGAAGACCTACGAAGGAAACGTCAGAGAGGG
TCACAGGAAAAATCACCGTCACCAGGGACCTCATTTTTCAGCGAAGGGGA
TCTCGAATGGTTACGGAAAAATAAGGCAAACGTGCAACAAAAACGGCGAG
GCAGCCAATCGTCTGGTATCGGCCCCCTTCCGAATTTTCGCAACTCTAGA
AAACGTGTACGGACATCCTCATCCGCCGAGTTCCAACAACCATCATCCAA
ACGTCGCCAGTCATGGAGGGATCAGAACCGCACCGTGCAGTCGTCTCCAG
GGTATCGATATGGGACAGGGGAGGGTAAGGATGGCCTCGAACATGGCTTC
CACTCAAGTCCCCCTCGCACCCCACCAAGGCGCATAGCCAAACCAGGGAA
TGCGAACAAACCAGCGGGTGATCGTGGCGCTGATCTCTTGATATATCTTG
CAACATCCCCCTCCCCAGCTGGAGTAATGCCAAAAGCAAAGTTCACACCA
ACCACACC

Sequences in the Contig:

SY0AAB11YA18FM1