Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB11YA03FM1
Length(NT) : 551
Best Gene Model Blast : Link to GSTUMT00004012001 E-value : 2e-95
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2893 Score: 115 E_value: 6e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAB11YA03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGCCACCAGAAGACAAGGCATGGTGAGAGGCAACTAGCGGGAA
TATCTTGAATAAAGGAACGATAAATCCCCCTTCGTGACTAGAACCCATTA
TCGTGACCATCAACATCCAGCTCTATATTACAAGCCCTCCGACAATACTT
CTCACCGGTCCCTGGGCGTTTCTGTTGGACATTAACCAAAGTCAAGGTGA
GATTACTGCCCACACATATATTCCCGAAGTCATCCCACTTTTCTCCTCCC
CCGAACTATTTCCGCTCCGCGGTTGAAACCTTGAGCCGGAGCTTTCATCT
ATACCATGTCTTATCCACAGAATCAAAACCCCAACTATGGCGCTCCCGCC
GGTGCCCCGCAGCAAAACTATTATGCCCCCCCGGGACCCGGACAGCCATA
CCCGCCCAACCCACAAGGCTATCCAGCGCCCGGAGTTCCCCCCTCTCCGT
ACGCTGGCCAACCGCCTTACCATCAGCCACAAGGCTATCCCCCACCAGGG
C

Sequences in the Contig:

SY0AAB11YA03FM1