Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YN24FM1
Length(NT) : 419
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat protein
Accession: ref|XP_748605.1| Score: 278 E_value: 1e-23
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 278 E_value: 6e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 203 E_value: 2e-17
PFAM Definition: No Hit Found
Swissprot: Q1RJR6|Y317_RICBR

Sequence:
>SY0AAB10YN24FM1
TTGGGGGGCAGTGGTACGATTGCTGTTGAGCAGAAAAGATATTAACCCCA
ACACGCCAGATAAAGATGGACGGACGCCACTCTTTTTCGCTTCAGGACAG
GGACACGAGGTATTGGTGGAGCTCTTACTAGAACGCCATGATGTCGACCC
CAACATTCCCAATAAAATCGGTCAGACTCCCCTCTGGTTGGCTTGCAGCA
AGGGGCATGATAGAATAGTGAAGCTACTATTAGAACGGCAAGACGTCAAC
CCCAATATGCCGAACGATTGTGGCCAAACACCTCTCACTTGGGCAATTGA
AAATAGGGATTATGGAGCGGTGAGGCAGCTATTGGGACGGGAAGACACCA
ACCCTAATATTCCGGACAATAATCGCCGAACACCTCTCTCGTGCGCCGCG
TTGCTTGGGAGAGATGGAG

Sequences in the Contig:

SY0AAB10YN24FM1