Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YN17FM1
Length(NT) : 588
Best Gene Model Blast : Link to GSTUMT00008522001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59738.1| Score: 424 E_value: 3e-40
KEGG Definition: predicted protein
Accession: aor:AO090026000257 Score: 424 E_value: 1e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB10YN17FM1
TTGGCAGTCGATAATATTCATTCTCGTGATGAAGTTTCCTATCCTTTCAA
TTGCCCTCTCGGCCATCCTCTTTTTTCCGCTTGGCCTCACAACTGACGAT
TCTGACTCGGAGAGCCAACACTACTCTCAATGCCGATGTCTTCCGACCGA
TCCTTGCTGGCCTAAACCATCTGAATGGGCCTCTTTTAACGCGTCGGTTT
CTGGATCTCTGATTGCTGTCAAACCCGTTGCGTCACCCTGTCATGATCCG
GCATTTGATCAAGCAGCTTGCGAGAATGCCAAAACCAACTATAAGCTATC
AGTTTGGAGGGGAAGCTTCCCGGGTGGATATCAACAAATAAATTTTGAGA
CCTCAGCTGTTAAAAATGAGACCTGCTACATCGATACTCCCAGATCTTCT
CCATGCGGCCAAGGAAATGTACCGGTATATGCCGTTGCAGCAACCTCCCC
AGCACAGATTCAAAAGGCTGTCGACTTTGCTCGCGAAAAGAACCTTCGAC
TTGTCATCAAAAACTCCGGGCATGATTATCTTGGGCGATCAGCGGGTAGG
GGGTCATTGCAAATCTGGACACACAACATGAACAATAT

Sequences in the Contig:

SY0AAB10YN17FM1