Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YN11FM1
Length(NT) : 707
Best Gene Model Blast : Link to GSTUMT00007611001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00131
Accession: ref|XP_001246360.1| Score: 385 E_value: 1e-35
KEGG Definition: hypothetical protein
Accession: ang:An09g04080 Score: 376 E_value: 8e-35
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG3023 Score: 159 E_value: 6e-12
PFAM Definition: Aldo_ket_red, Aldo/keto reductase family. This family includes a number of K+ ion channel beta chain regulatory domains - these are reported to have oxidoreductase activity..
Pfam Number: pfam00248 Score: 124 E_value: 8e-08
Swissprot: P48507|GSH0_HUMAN
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005625 = Cellular component: soluble fraction
GO:0035226 = Molecular function: glutamate-cysteine ligase catalytic subunit binding
GO:0006536 = Biological process: glutamate metabolic process
GO:0006750 = Biological process: glutathione biosynthetic process
GO:0050880 = Biological process: regulation of blood vessel size
GO:0042493 = Biological process: response to drug
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>SY0AAB10YN11FM1
TTGGCTTGACTTCCGTCTCTTTCGGTTCCCTACGCTCAGTTCATCTCGTC
AGATTTTACCCCGCCATTGATCCCTCGCTATCGGTAGAACCAAAGAGGAA
AAAAAGGAGAAGCTCCAAAAATAATGGCTTCAAGATGCATTCTCTCAACC
GGAAATGTCATGACCGCTGGCGCGCAGGTTATCCGCAAACCGACCCTCGA
AAAGTCAAACACGGAGTTGGTTAACTCTTTGCGCGAAAACTTCAAAGAGG
CCTCCTCCACACTCCCGCTTAGCACAAACCCAAACATCGCAGCGACAAGC
AACCCGGAAACAAGGCTGGCACCGGAAGAGTGGACAAAATTAGGGTCAGA
TGGGGTCCTGTACGTTCCTACAGAAAGTGTAAAATTATTCTACCTCCCGG
GAGTCCCGTCCTCTTCTCGCTGCAGGCACACCGAAGAGGCCGTACGTCTA
GTTTGCAAGGAGCTCGGAATATCCTCTATTGACCTATTGATCGTTTCCTT
CCCCAACATCTCCTTTGACGCCGAAGACGAAGACATATCCTCGGAGGAAG
ACGTCAGCGAATGGGTTCGCACATATCGTACTCTCGAGGGTCTGCATTCA
GCGAAGAAGATATCCAAAATTGGATTGGCGGAGTTTGGCGCCACTAGGTT
GTCTCAATTGCTCCCGCAGACGAATGTTAAGCCTTCAGTCGACCAGATTA
ATGTTAG

Sequences in the Contig:

SY0AAB10YN11FM1