Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YN08FM1
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00006942001 E-value : 1e-121
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001257908.1| Score: 220 E_value: 2e-16
KEGG Definition: DUF500 and SH3 domain protein
Accession: afm:AFUA_6G07880 Score: 214 E_value: 4e-16
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1843 Score: 153 E_value: 3e-11
PFAM Definition: No Hit Found
Swissprot: Q9URW6|YIE2_SCHPO

Sequence:
>SY0AAB10YN08FM1
TTGGCTCAGACGTTCGACAAATATGAGAGTTCCAAGAGCACTCAATTCCA
GAGGCAGCATTTCAACAGCACCTACTCTGATAAATCACCTTCACCCAAGC
GGCCCACAGGGCCCAAACCGGTCTTCAAACCGAAGCCACTGTTCACCAAT
AAGGCCGAACTAAATGCCAACCAAGCTATTGCGCTATACACCTTTGAGGC
GGATCAACCAGGCGATTTGGGTATGAAGCTTCTCACCAATTGTGAATCCG
TGGTGTAGATGGAACATGTTTGCTGAATATTTCCACAATTAGGTTTCAAA
AAAGGTGATATCATCACCATCGTAAAGAAGACCGATTCAAAAAACGTTTG
TATCGCTTGGGAGAGTGCGATTGTGCAAGAGCTGACTAACTCCTTTTAGG
ACTGGTGGACTGGAGAGATCAATGGTAAAACAGGAATATTCCCTAGGTAA
GTGACAGTTTCCCCTCACTCCTTCCTGCATGGAGGGAGAAAGGGGGGAGA
AAAACGTGCTGTTTTAGATCTTGGAAGCTTATGATTCAATACGTTTACTA
CAGCAATTATGTTGAGACCATGTGATGTTCTCGATTGGGTTGAGGAACGA
GAGACGTGGTGGCGAGGAGAAAAGGTAGTTTTTTTTTTCTT

Sequences in the Contig:

SY0AAB10YN08FM1