Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YJ18FM1
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00005820001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: alpha-amylase 1
Accession: gb|AAZ73168.1| Score: 610 E_value: 9e-62
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g979 Score: 582 E_value: 8e-59
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0471 Score: 247 E_value: 3e-22
PFAM Definition: Alpha-amylase, Alpha amylase, catalytic domain. Alpha amylase is classified as family 13 of the glycosyl hydrolases. The structure is an 8 stranded alpha/beta barrel containing the active site, interrupted by a ~70 a.a. calcium-binding domain protruding between beta strand 3 and alpha helix 3, and a carboxyl-terminal Greek key beta-barrel domain..
Pfam Number: pfam00128 Score: 355 E_value: 9e-35
Swissprot: Q02906|AMYB_ASPAW

Sequence:
>SY0AAB10YJ18FM1
TTGGGCAAAGGGAATGTACATAATGGTTGACGTCGTTGTCAATCACATGG
GCGCGGGGGATATCACAACCTTCAACCCCTTCAACTCAAGCTCGTACTAC
CACCCCCGCTGCAGTATCAATGACGACGACCAATGGAGGATCGAGCGATG
CCGGATCGCGGGACTCCCGGACCTCAGGACGGAGAACACCACGGTACGCA
GGTTGCTCTATGACTGGATCAGGAACCTGGTGTCGGAGTACTCCATCGAT
GGACTGCGCCTGGACACGGTGAAGCATGTAGAGAAAGGCTTCTGGCCTGG
CTTCACCAGTGCTGCGGGCGTATACTCTATAGGAGAAGTGCTCAACGGCG
ACCCGGCTTACGTCGGCCCATACCAGAATTACGTGCCCGCGCTCGTCAAC
TTCCCCATGTACTACTCCATCAACGACTGCTACGCGCGCAGACATGGGCT
CTGGGACCTCGTCAGACAGCACGACAGGGTCAGCTCTGCGTTCTCCCGTC
CGGAACTCCTGGGGACATTCCTGGACAACCATGACGTTCGGCGCTTCCTA
AACATCAACAACGACTGGACCCTTCTCAAGAACGCTCTCGCCTACACCAT
GCTCGCCCGTGGTATTCCCATCCTGTACGGTGGT

Sequences in the Contig:

SY0AAB10YJ18FM1