Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YJ07FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00010271001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_08711
Accession: ref|XP_001589947.1| Score: 635 E_value: 1e-64
KEGG Definition: hypothetical protein
Accession: ncr:NCU07890.1 Score: 580 E_value: 1e-58
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB10YJ07FM1
TTGGAGACCCTCAAAATCTCATAGCGATATGTTACTGGGTCAAGTCTCAT
GGCTCGATATACTCGTTTTCGTGGTATTCCTTACATGGCGATTATTGCGC
GATGTGGGGATCTACGGAACTGTCATTTGCGCGATTCAAGCACTCCCATT
TCTATGTTGGAGAATGCCAACTGATATAATAAAGGAGCGCTATCTCACAA
AACATAATCGACAATCTGCATTTACACGACGGAGCACACTCTTCCAAGCA
CTTGTCGTAGCTTGCATGAGGTATGGCTTTACATACGTGCCCACTAGAAT
CGGTCGTGTATTCTTCACGAAAGGAGTTGCTCTGCCATTCCTGAGATTTA
GAATGTTCAGGCATGGCTACATTTGGCACCTCAGACACAGGCCATTATGG
AGGGAAATCAACTTGAATAAAGGTGCCATGAAGGGTATTTGGATAGTGGA
GGATGATATCAAGAAGCCGGATGTGGTGGTTTATTACTGCCACGGTGGAG
GCTTCGCTATGGGAACGTGCTACTTCTACCTCGAATTCCTCATTTCGTGG
GTTTCGATTTTGAAGGAATCTGGCTTCTCTAACCCTGCGATATTCGCCGT
GGAATACACGCTTGTTCCGGACAAAAGGTACCCGGTTCAGCTT

Sequences in the Contig:

SY0AAB10YJ07FM1