Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YI22FM1
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00006131001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001542869.1| Score: 429 E_value: 1e-40
KEGG Definition: hypothetical protein
Accession: ang:An17g02120 Score: 383 E_value: 1e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38678|GS1_NEUCR

Sequence:
>SY0AAB10YI22FM1
TTGGCCTCAACAACCTTTACTCCTCCTCCTCCTGACCAACAAACAAACCA
TCCTTACTTCTTCCCCACATTCCTTGGTCCTGGGTACTTCGAGAAAATCT
CGATCGTTTTATTCTCTTCCTTATAAACCACTTGGTCCGGTCAAAACTGG
CGGCCCCTTCAATCATGGCTCCTGGACTCGGTTCGGGATTCCGCTCCTTT
TGGCACGCGATGACTTCAAACGACAGGCATGCGAACCACGATTCCCCTTA
TAGATCTCATTCGAACATGGGCAGTCAACACATTGGCGTCGGTCGTAACC
CTGGATTACAATCCGTTTCCTCACCCGGTGCCGACACCAGTCTCAATCTT
GGCTACCGCGATGAGAACCATTCTACCACCGCTCTCGCTTCCCAAAACGG
CGTTTATTCCCCGAGGCCTCTGAATGGAAACATCCAAGGTCCGAATTCCC
CCTATTCTCCGGGCATGAGGTCTTCCGCTTTGCAGAGTGATGGTTCCCCA
GGAGGAATAGCTCTGCAAGACTTTGGTACGGATGGTTTACCTCCGCCTCC
CCCTGTAAGTCATTCCTGGAGCAGGATCGACCGGTGGTGCGAGGATAACT
ATCCTGAGCTCTTTGATCAACTGTGCACTCCCGCATCGGTGAATGACATC
AACGAGTTGGAGTACAACCTGGACTGTTCGCTACCCATCGAAGTGAGGGA
CTC

Sequences in the Contig:

SY0AAB10YI22FM1