Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YI15FM1
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00011112001 E-value : 1e-69
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213350.1| Score: 560 E_value: 7e-56
KEGG Definition: hypothetical protein
Accession: fgr:FG10284.1 Score: 556 E_value: 1e-55
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0029 Score: 235 E_value: 9e-21
PFAM Definition: Amino_oxidase, Flavin containing amine oxidoreductase. This family consists of various amine oxidases, including maze polyamine oxidase (PAO) and various flavin containing monoamine oxidases (MAO). The aligned region includes the flavin binding site of these enzymes. The family also contains phytoene dehydrogenases and related enzymes. In vertebrates MAO plays an important role regulating the intracellular levels of amines via there oxidation; these include various neurotransmitters, neurotoxins and trace amines. In lower eukaryotes such as aspergillus and in bacteria the main role of amine oxidases is to provide a source of ammonium. PAOs in plants, bacteria and protozoa oxidase spermidine and spermine to an aminobutyral, diaminopropane and hydrogen peroxide and are involved in the catabolism of polyamines. Other members of this family include tryptophan 2-monooxygenase, putrescine oxidase, corticosteroid binding proteins and antibacterial glycoproteins..
Pfam Number: pfam01593 Score: 231 E_value: 3e-20
Swissprot: P31225|CBP1_CANAL

Sequence:
>SY0AAB10YI15FM1
TTGGGTGAGGTAGACGCCGTAATCGTAACAATACCCTTGGGGTGTCTCAA
GAGAGAGATGATCAATTTTCAACCAAAACTCCCGAAGCGAATGCTTGAGG
GCATAGATTCCCTTAGCTATGGAACTCTCGAGAAGGTCTACATCAAGTTT
TCCGCCCCCTTCTGGAGCGGTACGGGGCAGGACTTTTTCACTTTTCTTTC
GCCCAAGTATGCCCCCAAAGTAAACCCTAGTCGCTGGCATATGGCGTGTT
TCTCGCTTGCTGGATTACCAAAACCCTGTGCACAGCCCACACTTCTATTC
TACATTTTTGGTCCCATTACCAAGCATTTAAATGAGAATTTTGCACCCAG
TCAAACAAAGGCCGGCAAAAAGCAGTACTTTGAGTTCTTTGAACCGTACT
ACTCTAAACTCCCAAACTATTGTGAGGGCAGCCCAGACTGCCGGCCAGTG
GATGTTGAGGCAACACGATGGAGCCAAGACAAGTGGGCCGGCTATGGAAG
TTACTCAAACTTCCAGGTCGGCCTACACGCTGGTGAGGAGGACATCAGGT
GTCTAAGAGCCGGTGCAGCGGATCGGAAACTCTGGTTCGCCGGAGAGCAC
ACTTCTCCGGTACTAGGTCTCGGAAGTGTCAGTGGGGCATACTGGAGCGG
AGAGGACGCAGCCGCCAGAGTAATCGCCAGC

Sequences in the Contig:

SY0AAB10YI15FM1