Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YH11FM1
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00003608001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01686
Accession: ref|XP_001247915.1| Score: 375 E_value: 2e-34
KEGG Definition: microtubule-associated protein
Accession: aor:AO090003000421 Score: 358 E_value: 9e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB10YH11FM1
TTGGGCGAAATTGTTTCAGGAAATCAATGAACTGCAACTTCAGAATGCTC
AACTGATTGAAGATCATACACGGGATAATCTTTCAATTCGTGCCAAGGAA
GCCCAACTCGTCCGTGCCCGCTCTGACGCGGAAACTGCCGAAGCTACTGT
TCATAAGCAGCAGCGTGAAATGGAGCGTTTGAAACGGGAACTGGCTCGTG
CGGTGCGTCCTACCTCACCGGCGCCTACCGATATCTCGGAACATGTTTAT
CGTGATAATGGCCTAAATGGCTCTTACAACAGTGGAAGAAACGACTCCGT
AGGAAGGGGCGCCGGTAACCGCCTTAGCTTCGCTTCGACATTTTCGGGTG
AGGACAAGGAGAATGGATATGACAGGGGTTCCCGAATGTCCCCAACTTTA
CGCGAAGGCACTGAAAGTGGACGGGCAAGCGCAGCGGGAAACAGAGGTGG
TGCAGATTCCATTGAGAGTTGGAAGCGGGCCGCCGAGGTTACAAGCCAGC
TGAAGTTAAGAATCGAGCAAATGAAAGCAAAACAAGGACTGGCAAGAAAT
CAGCATTAGTGGTGTTTTGGTGTTGTTACTGCGGGTTGTAATTTCAGGGG
ATTGGGCGAGGGGGTTCAAAACGGATCCGGAGTTTCATTGTTTGCTAAAT
GACTGAAGAGAATCACCAAGGAGTGGAGAAAACAAAA

Sequences in the Contig:

SY0AAB10YH11FM1