Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YH06FM1
Length(NT) : 725
Best Gene Model Blast : Link to GSTUMT00000793001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_09584
Accession: ref|XP_001589862.1| Score: 380 E_value: 6e-35
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01074 Score: 337 E_value: 3e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q09731|YA4E_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB10YH06FM1
TTGGCTTCTAATATCGCACACGCTGGAGAGGCGGCGCCCCTGCCCACCAC
CAATGAAGAAGAGAGTGGACCGAGAGCTTCTCTTTCTCCTACTACGAGAG
GGTCAATTGACAAGCTAGCTACTGGTGACTATTTCTCAACCGGAAGTACG
AGTAATGCAACGCCAACCAAACCAATCTCATCCGGCCCCTCACTAGGTGA
AGCAGTTGACGATGCTCCCGCAACCCCCTCCACAGCCGACAAAGAAAAGG
AAGAGAAGGATTCATCGCTTCTTGGAAGATGGAGATCGTTTGGAACTAGG
AAATTGGGCCGCTCCGCCTCTACTGACACGGCAAATAAACCCACTGTATC
AACAGTCGACGAAAAGCCATCCGGAGACGAATCTGCGATATCCGATAAGC
CCGACCCCTTAGAGGATACGCTGCTAGGTGTCTTAAAGAAGATCCGGGGA
TCCTACGAGATTCAAGTTCGGGAAAGGGTGGGCGAACCCTTCAGGAGCAG
CATTGCTCCCAGCTTGCCTCTCGAAACGCCAGTTTTAAAACCTCCCGGAA
ATACTACGATCATTATCCAGGAGGACAGGCTTGATTTCGGAGGTGTTGCG
GATCTGTATAGGGGCACAGTCTCTTGTGTTGGCGAGGATGCAGACTTGCT
CGAGAAAGTTGCCCCAGCCTGGCTAGGAGACCTTATTCTCCTTAACCGTA
TCCCGCTAAAGGATACCGTGAAAGT

Sequences in the Contig:

SY0AAB10YH06FM1