Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YF21FM1
Length(NT) : 701
Best Gene Model Blast : Link to GSTUMT00007445001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_14553
Accession: ref|XP_001804735.1| Score: 126 E_value: 9e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU02375.1 Score: 111 E_value: 9e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB10YF21FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCCGACCAGATCTCCGAGC
TCAAGTCGCCGCTTCCACCCCTCTCCCTTTACCGCATCACTACCAACCAC
GCACCTCTCACACCCACCACCCACCACCCCGGACACGATTGTCCACCGCC
ATGGGCTCAACCACCATATTGAATCGCCCGCAGGCTGCTTCCGCATTGTC
AGCTTCACCAAAAGTTGTCAAAAACAACAAATCTCTCGCTAGCAGTTCGG
CCGCTCCTTTAACCTATGGTTGTAACCATATCGAAAAGCCTCTACAGGGC
CCTACGGAGGGTAATAAGATGAGGGTCCTTTACGGTAGCGCCACTCGTGT
GGCTTTGGATTCAAGCCGGGCACATGCGCAAACTTGTGAGAAGTGCAAGT
TTCTCATAACGAGAACCTTCCTTTGCATGCAATGTCCGAGTATATACTGT
CCCAAGGACGCAGAAGCTCACTATAAGGAAAAGAATCACCGTTTTGGTTA
GTTGGTCCGGACTTGACGAACGGCCATGTTTACTGCTTCCCTTGCCAGGA
CTTCATATATGATCCAGCATTGGAGAAAATTAGGGTGGAAAAGGAGGTAG
CTATGGAGGGGGGTGCTCGGAAAAGGAGGCGATTGGATGATATCAAACCC
TCACCCGAAGATCTTAAGTACATCGAGTCGAATACAACACTTGCGCCCTG
C

Sequences in the Contig:

SY0AAB10YF21FM1