Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YF09FM1
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00003782001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein ATEG_06948
Accession: ref|XP_001209634.1| Score: 732 E_value: 7e-76
KEGG Definition: hypothetical protein [EC:2.4.1.-]; K00754
Accession: ani:AN4623.2 Score: 717 E_value: 2e-74
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1879 Score: 839 E_value: 8e-91
PFAM Definition: No Hit Found
Swissprot: Q09140|UGGG_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0003980 = Molecular function: UDP-glucose:glycoprotein glucosyltransferase activity
GO:0006950 = Biological process: response to stress

Sequence:
>SY0AAB10YF09FM1
TTGGCCAGATTGTCAAGAAACCCGGGAATGGAAGTCGAGGATGTCCTTGA
ACAGTCTACTGGTGTGCCAGGGAATATTGGTGACTTTGCTGCCAAGTTTT
TGAGGAAGGTGGAAGACGTACTTGTGAATATCGGATTCCTTGCACCGGCG
GTGGATTTGAAACCTCAGGCTGATATCAATATTTTCTCCGTTGCCAGCGG
CCACCTTTACGAAAGATTTTTGAACATCATGATGCTTAGCGTCATGAAGC
ACACCGACAAATCGGTCAAATTCTGGTTTATTGAGAACTTCTTATCTCCC
TCGTTTAAAGATTTTATCCCGATAATGGCTAAGGAGTACGGCTTTGAGTA
TGAATTGGTCACATACAAATGGCCCCATTGGCTTCGTGGCCAAAAGGAAA
AGCAGCGCGAGATTTGGGGATACAAGATTTTGTTCCTTGACGTTCTCTTC
CCCCTCGATCTCGACAAAGTCATCTTTGTCGACGCTGATCAGATTGTCCG
AACAGACATGAAAGAGCTCGTTGACCTGGATATCCAGGGCGCGCCATACG
GCTTCACGCCAATGTGTGATTCTAGAGAGGAAATCGAGGGCTTTCGCTTC
TGGAAGCAGGGCTACTGGAAGAGCTTCCTGAA

Sequences in the Contig:

SY0AAB10YF09FM1