Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YF03FM1
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00011560001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01175.1
Accession: ref|XP_381351.1| Score: 420 E_value: 2e-51
KEGG Definition: hypothetical protein
Accession: fgr:FG01175.1 Score: 420 E_value: 8e-52
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3031 Score: 466 E_value: 1e-47
PFAM Definition: Brix, Brix domain..
Pfam Number: pfam04427 Score: 194 E_value: 5e-16
Swissprot: Q9UUG1|BXDC1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus

Sequence:
>SY0AAB10YF03FM1
TTGGCTCTCCGATCACTACTTGCCCCACCAAAATGATTCGCACAACAAAA
CCCCGGAATGCCCGCTCAAAGCGGGCTCTTGAAGCCCGTGAGTGCAAACT
TGTCGAAAACCAAAAGAGCGCACTTTTTCTTTCGGGCACAAGTACTAGCG
ACCTAACACGGTCCGCAATGACCGACATTGTGCATTTTCCACATCCCCCA
TCAGCTTCAAGAGACATACTAATTACGGTGCTCATCCACCCAGCACTCTC
TCAAAAAACCCAACGCAATAAAGTTCACGAAAAAGAACAGCATCCACCCA
TTCGAAGACGCAACACCTCTTGAATTCTTCTCCTCAAAAAACGACACGTC
GTTCCTCGTCTTCGCCTCACACTCCAAGAAGCGCCCGCACAACCTAACTA
TCGCCCGCACCTTCGATCACCGAATCCTAGACATGTTAGAACTCGGCATA
GACGAGAGCACCTTCCGCCCGCTGACATTTTTCAAGACTTCGAAACCCGG
AATCGGAATGAAACCGTTACTATCCTTCTCCGGGGCAATCTTCGATTCGA
TACCGAACTACCGGCTCTTCAAGAGCATGTTCCTAGACTTTTTTCGTGGG
GAGACGGTTAACTCTGTGAATGTCGAGGGGCTGCAATACATGATACACTT
TTCCGCGGCCGAGTCTACAGAGCAGAACCCT

Sequences in the Contig:

SY0AAB10YF03FM1