Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YE16FM1
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00005145001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00431
Accession: ref|XP_001598345.1| Score: 420 E_value: 1e-39
KEGG Definition: hypothetical protein
Accession: fgr:FG02596.1 Score: 409 E_value: 1e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P41800|MMM1_YEAST
Gene Ontology:
GO:0032865 = Cellular component: Mdm10/Mdm12/Mmm1 complex
GO:0000002 = Biological process: mitochondrial genome maintenance
GO:0045040 = Biological process: protein import into mitochondrial outer membrane
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAB10YE16FM1
TTGGTAATTCACCAGTTTTTTTCTTTCCCCTCCATTCCACTTCTCTGGTT
TGTATCATACTGTACCCCTTGTCGTTCTTCAAGTAACTCTCGCCGCGCAA
CCAAACGCATGCAGCAGGAACGCCACATACAGCTTCCGTTATCGGAATAC
CTTGCTCTTACTACGAAACAATGTTCTAGCTGGTCCTTCACCCAAGGCCT
CCTCTTAGGCCAACTGATCGTAATCCTAACCCTCGGCTGCTTCATAAAAT
TCTTTATATTCGGCGACTCGCCCGGCTCCACTTCGAAAACTATCTACTCA
GGGTCCTTCACGCCCACCGCCCTAAAACAATTCTCTCGGAACCAATCCAA
CCTACGAAAAAAGCGTTCCGCCGTCCTCCGTGACCCCCCGTCGCAATCCA
CAGAGACGATCCTGTCGAAGACGTACTACGATGTGCGCTCCCATCAGCCC
GAATCCCTCGACTGGTTCAACGTGCTCATCGCTCAGACGCTAGCGCAATT
CCGCGAGGACGCTCACACCGATGGTGCGATCCTGAAGTCACTGAATAAAT
TCCTGAACGGCCCGCAGAAGCCGGACTTCTTAGACTCGATCCGGGTGACG
GAGGTCTCCCTCGGGGAGGACTTTCCCATCTTCTCTAATTGCAGGATCTC
GCCGAGTGATGATGAACCCGGGAAGTTGCAGGC

Sequences in the Contig:

SY0AAB10YE16FM1