Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YC21FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00000908001 E-value : 1e-137
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 183 E_value: 3e-12
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 172 E_value: 3e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 140 E_value: 9e-10
PFAM Definition: No Hit Found
Swissprot: Q6S5J6|KRIT1_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0005083 = Molecular function: small GTPase regulator activity

Sequence:
>SY0AAB10YC21FM1
TTGGAGCTACTGTTGGAACAAGAAGACGTCAACCCCAATATTCCAACCAA
TTTTGGTAGCACACCGCTCTCGTGGGCTGCTAGGAATGGGCATGATGAAG
TAGTGAAGCTGCTATTGGGACGGGAAGACGTCAACCCCAACTTATTCGAC
AGAGAAAGTAAAACACCACTCTCCTGGGCTGCTGAGAACCGCCACGCAGG
AGTCGTGAAGTTACTACAAGCGCGCATCCACAAGCCTAGCCCGGCGTAAC
CCCAACAATACAGTTATAAAAACCGCCACCCGCAGCCCCCTGATAGATAC
ACCCTTGTGCCCGCCAGCCGCACCACCCTCCCCGAAATCACTCGCATGAC
CCTTTTTAGGGTGTGCACCAATTCTGGGGACACCGCTTTCCTCTCCTCCC
CCACCCTTCTCCCTGATCCAAGCTAAAGCCCACCTTGAAAGCCATCACTA
CCCGCACTCGAAGCTAGGGACGAAATATGCACATGCCCGTCAGGCTATCC
AAGGGCATTTCCGGCGGTTGAGTTAGCAGTTCTTATCGGAGTATTGGTGA
AGGTGTGCTGTTCTTGTAGTTCCAATGGGAATGTTTATTCCATGCTTTAG
CCTTATTTAATTCCTTTAT

Sequences in the Contig:

SY0AAB10YC21FM1