Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB10YB02FM1
Length(NT) : 455
Best Gene Model Blast : Link to GSTUMT00011880001 E-value : 5e-71
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB10YB02FM1
TTGGCTTGATTTTCTCGCCCTTTATGTGGTCTCTCTCGGAACAATCCAGA
CTCGTTAGGCTAACCAGACGTTCCCAGTGTGCCCGCGACTGGAGCAGAGT
TTCGCGGATGGTACTCGATGTGCGCGATAGCTGTATCACTATGTTGTTTG
TCAGCTCGATCCCTCCTCTTCCGCCTAACCGACATTACCGAGAAAGTCGG
ACAAGTAGAACAAAAGACAAACAAACAAGAAACCACATACAGTCGCCGGT
AGTAATCATCTTTGCAAGTTCAGTAACGACAGTATAATGCGAGAACAGCA
ACGCCAAAGTATCAAACTTTGGCGGGGGGTCAAGTTCGTCGACAACCATC
ATCACAGCTCCCTGGAAAGAGTGCAGAGAAAGGGAAGGCAAGCAAGCTAA
TCGTGGTCGTAAGCTGAAAACTTAAACCGTTTGTAAAGCCAGGATCTTCA
AAGTT

Sequences in the Contig:

SY0AAB10YB02FM1