Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YP07FM1
Length(NT) : 719
Best Gene Model Blast : Link to GSTUMT00001255001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An02g04540
Accession: ref|XP_001399591.1| Score: 987 E_value: 1e-105
KEGG Definition: hypothetical protein
Accession: ang:An02g04540 Score: 987 E_value: 1e-105
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2161 Score: 300 E_value: 3e-28
PFAM Definition: No Hit Found
Swissprot: Q04336|YM54_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAA9YP07FM1
TTGGCTCTTACTCTTCACCTTCCGACTTTATCGTTCATCCCGTCAACCAG
AAATGGGTGAAACACGGCCAACACGAGTACCTTACGCAGGAGGAGAGGAG
ATTGAAGGAAGACAGGGAACGGAGGAAGTATTGGAAGAAATGGGGTCCCT
ATCTCAGCGAGCGGCAATGGGGAACTGTTCGTGAGGATTACTCCGAGAAC
GGAGATGCATGGAGCCACTTTCCTCATGACCATGCGAAAGCCCGCACCTA
CCGCTGGGGTGAGGACGGGATTGCAGGAGTGTCAGACACTCATGGCCTTC
AGAATATCTCCTTTGTGTTCTGGAATGAGCATGACGACTTCTTGAAAGAG
CGTCTCTTTGGCCTTTCGAATCCCCAGGGAAATCATGGGGAGTCTCTCAA
GGAAGCGCATTTCCATCTCGATAATACACCTACCCACTCCTATATGAAAT
ATTTGTACAAGTATCCTCAGCGAAAATTCCCCTATGAGCAATTGGTGGAG
GAGAATGGCAAGCGAAGTCGACACGTGCCGGAATTTACTCTGATGGACAC
CGGTATTTTCAAGGATGATCGGTATTGGGATATCTTCATCGAAACTGCTA
AGGATACCAACGACGAGGAAGAGCTTCTTTTCCGTGTCACGGCTTGGAAT
CGTGGGCCCGAGCCTGCACCTTTGCACATTATCCCGCATATGTGGTTCCG
TAATACTTGGGCTTGGGGC

Sequences in the Contig:

SY0AAA9YP07FM1