Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YO17FM1
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00004046001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG03419.1
Accession: ref|XP_383595.1| Score: 488 E_value: 2e-47
KEGG Definition: hypothetical protein
Accession: fgr:FG03419.1 Score: 488 E_value: 8e-48
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0351 Score: 284 E_value: 2e-26
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 193 E_value: 7e-16
Swissprot: Q19546|WRN_CAEEL
Gene Ontology:
GO:0008340 = Biological process: determination of adult life span
GO:0040007 = Biological process: growth
GO:0010212 = Biological process: response to ionizing radiation

Sequence:
>SY0AAA9YO17FM1
TTGGAGGCAATGCATTATCATGCTGGTATGACCAAAGATGAAAGATCATA
TGCTCAAGACGAATTTATGAACCGGAACGATTTAACGATTGTTGCCACGA
TTGCTTTTGGTATGGGCATTGATAAGCCCGATATCAGGAATATTGTCCAT
TACGACTTCCCGCGTAGCTTAGAGGGCTACAGTCAAGAAATTGGACGCGC
CGGCCGTGACGGCAACGAGAGCAAGTGTATGCTCTATCTCTGCGGAGAGG
ACTGGGTCCAACGTGAATTTTTTTGCCGCCTGGATCTGCCAAGCAAAAAG
AGTGTTAACAACCTTCTAAGGGAGCTGTTCGCATCGAATGAGGGGGTTGA
GGTCGGTGATGTCATAGAGACGGATATCAATCTGCAAAGCAGGAATCATG
ATATCAAAATAAACGCTCTTAACCTTCTCTATTCCCAACTTGAGCTTCGC
TTTGAGCTTTTGCGGGCCATCACACCAAAGTACTCGACATACAGGTTTGT
GCAGTCCGATGGTTTTGCGAGTTTTACCGCTACCGACGATCCCATCACAA
AAGTTTTGCTAGAGAGCATGCAAAAGAAAATTAAACGAAAATCAATGATG
AGATCCGTGGATATTGATCAACTCAGCCAGGAGCATGGATTCAAGCGCGA
GGAACTAGTCTATAGAATGCAGAGCTTTTCGGCC

Sequences in the Contig:

SY0AAA9YO17FM1