Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YO02FM1
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00010862001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: alpha-glucosidase AgdA, putative
Accession: ref|XP_001271891.1| Score: 291 E_value: 4e-36
KEGG Definition: CGA1; Glucoamylase 1 precursor (Glucan 1,4-alpha-glucosidase) (1,4-alpha-D-glucan glucohydrolase) [EC:3.2.1.3]; K01178 glucoamylase
Accession: pic:PICST_56703 Score: 300 E_value: 7e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1066 Score: 265 E_value: 3e-24
PFAM Definition: Glyco_hydro_31, Glycosyl hydrolases family 31. Glycosyl hydrolases are key enzymes of carbohydrate metabolism. Family 31 comprises of enzymes that are, or similar to, alpha- galactosidases..
Pfam Number: pfam01055 Score: 221 E_value: 4e-19
Swissprot: Q12558|AGLU_ASPOR
Gene Ontology:
GO:0004558 = Molecular function: alpha-glucosidase activity

Sequence:
>SY0AAA9YO02FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAATCCCTAGTCGAGGTCG
ACCGCCAGTTCATGTTAGGTCCGGCGATCATGGTTACTCCGGTATTAGAC
CAGGGCGCAAATTACACCTATGCTACGTTCCCAGGCGGGAAGAACGAGAA
GTGGTACGATTGGTACACATACGAGGCTAGAAGTGGGAGTAATGGAAGCT
TGGCAAATTTAACAGCGCCGTTGGGACATATTCCGGTGTTTGTTAGGGGG
GGTAATATTTTGGCTTTGCAGCATCCGGCATACACAACCGCGGAATCTCG
GAAGAACCCTTGGGATGTCCTCGTCGCATTGGATTCTGAAGGGGATGCAT
ATGGAGATTTGTACCTTGATGACGGGGAAAGCCTTGTTCAGGAGAAGACT
GTCTTCATAACTGTATGCTCACCCCGCCTCCCTGCGTTTTATTAAAATTT
AGCACTTACAACCCCCAGCTCGAAGCAACAAACTCCCTCCTCAATGTATC
GCGAAAGGGGCAATGGATCTCCAAAGAAACACTATCGTCGGTAATTATCC
TAGGGGTATCAAAGAAGCCTGATCAAATCACGTTTGGAAAGGAGAAACTT
GACAAATGGAACTGGGAAGAGAAGAGTCAAGTTTTGAAGATGACGGGGCT
CGAGTTGGTGACG

Sequences in the Contig:

SY0AAA9YO02FM1