Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YN06FM1
Length(NT) : 509
Best Gene Model Blast : Link to GSTUMT00006821001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glycerol:H+ symporter (Gup1)
Accession: ref|XP_749635.1| Score: 276 E_value: 3e-23
KEGG Definition: glycerol:H+ symporter (Gup1), putative
Accession: afm:AFUA_2G05040 Score: 276 E_value: 1e-23
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3860 Score: 107 E_value: 4e-06
PFAM Definition: No Hit Found
Swissprot: Q09758|YA71_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006506 = Biological process: GPI anchor biosynthetic process

Sequence:
>SY0AAA9YN06FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTCAATTCCTCGTACCGCCCGTCACACAACATCAATCGACGA
AAGTGCTTCAACATCTTGTTCGCAGTTATATTTCTAACGGCACTGCACTC
GCTCAGTATCATCAAGATTCTCGTTTTTCTCACCGCGAATTGGCTTATCT
CCTTCTTTCACCCCAGCTCTATTTTTGTGCCAATTTTGACTTGGGGGTTC
AACATTGGCGTTCTTTTTGCGAACGAGTACTTTGAGGGTTACCACTTCCG
CCTCATTCTCCCATGGCTAATTGCCGGAGAAGGCGCCGGGGTCGGGTATG
CGATGGACCACTTCCTCAGTGGAGGATTACTCCCGCGCTGGGAAATTAGC
TTCAACATTACGGTTTTGCGACTCATCTCTTACAATATGGATCACTACTG
GGCCGCCAAGCGACTGGAGGAAGCAGGCGATGTGATTGTTGGAAGGGATG
AGGGAATTG

Sequences in the Contig:

SY0AAA9YN06FM1