Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YK18FM1
Length(NT) : 367
Best Gene Model Blast : Link to GSTUMT00005825001 E-value : 1e-112
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG10831.1
Accession: ref|XP_391007.1| Score: 177 E_value: 7e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG10831.1 Score: 177 E_value: 3e-12
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3158 Score: 117 E_value: 1e-07
PFAM Definition: No Hit Found
Swissprot: Q11118|WOS2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0030189 = Molecular function: chaperone activator activity
GO:0005515 = Molecular function: protein binding
GO:0007346 = Biological process: regulation of mitotic cell cycle

Sequence:
>SY0AAA9YK18FM1
TTGGGGGGGGGCGAATATTGGGAGGATGTCCTCGAACATGATGCCCGGCT
TTGGGAAGTCGGACGAGCCAACTCATCTCTTCTCTCTTCATCTTCTCTCT
TCACTGCTCTTCCCCTCTTCAACTAATCTATCATCCACACTTCAACTTTC
CACCTCTACCAAACATGTCTTTACCAACTACTATTCCTGAAGTTCTTTGG
GCCCAGCGTTCTCATGAGGAAGATGGCACCAAAAACATCATCTATCTTAC
CATAACAGCACCAGACTGCCCCCCAGACTCGGTTGAATTGGATCTTGAGC
CAACAAAGGTCCACTTCAAAGGAAGCAACAAAGTTAAAACTTTCTGTGTG
GATCTGGAGCTCTATGC

Sequences in the Contig:

SY0AAA9YK18FM1