Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YJ11FM1
Length(NT) : 580
Best Gene Model Blast : Link to GSTUMT00006967001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 493 E_value: 3e-48
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 469 E_value: 9e-46
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 276 E_value: 1e-25
PFAM Definition: No Hit Found
Swissprot: Q92625|ANKS1_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAA9YJ11FM1
TTGGCGGCTGCTGAGTATGGACACGAGGGAGTTGTGAAAATACTACTCGG
ACGGGACGACGTCCACCCAGACAAACCAGATAACACCGGCCAAACACCAC
TCTTGTCGGCTGCTGAGAATGGACATGAGGGAGTGGTGAAAATGCTACTC
GGATGCGACGATGTCAACCCCGACAGACCAGATAACACCGGCCAAGCGCC
ACTCTTGTCGGCTGCTTGGAATGGGCGCGAAGCAGTTGTGAAAATACTGC
TCGAGCAGGGCGAGGTCGACCCTAACAAGCGAAATAATCATGGCGAGACG
CCACTCTCGCTCGCTGCTTGGCTTGGACACGAAGGAGTTGTGAAAGTGCT
ACTCGGGCGGGACGAAGTCAACCCTGACAAACCAGATAACTATGGCCAGA
CACCGCTCTGGTGTGCTGCTGAGGGTGGAAATGAGGGAGTGGTGAAAATA
CTGCTTGAACGGCACGACGTCAACCCAGACAGACCGGATAAAAGCGGCCA
AACACCACTTTTGTCGGCTGCTTGGAATGGGCACGAAAGAGTGGTGAAAA
TGCTGCTCAGACGGGACGATGTCAACCCCG

Sequences in the Contig:

SY0AAA9YJ11FM1