Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YJ09FM1
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00008957001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08671
Accession: ref|XP_001798980.1| Score: 754 E_value: 2e-78
KEGG Definition: hypothetical protein
Accession: ang:An18g01960 Score: 740 E_value: 5e-77
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3730 Score: 234 E_value: 1e-20
PFAM Definition: Acyltransferase, Acyltransferase. This family contains acyltransferases involved in phospholipid biosynthesis and other proteins of unknown function. This family also includes tafazzin, the Barth syndrome gene..
Pfam Number: pfam01553 Score: 146 E_value: 2e-10
Swissprot: A3N1B3|PLSB_ACTP2
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0004366 = Molecular function: glycerol-3-phosphate O-acyltransferase activity
GO:0008654 = Biological process: phospholipid biosynthetic process

Sequence:
>SY0AAA9YJ09FM1
TTGGGTGAGATCTCCCTTCATTATAGCGGTACAGGATGGCGTGCATACGA
CGAACCGATTGGCCAGAAGATATTCTACAAGGGATTCAGCGATGAGATGA
AAGCGCGTGTGCTGGATAGCAGGATGTTGAAGGCTAAGCTGCAAGAGTTA
GCAGGTCGGAGGGTCGTGATAGAGGATGAAATGGGGTTGTTCGGCGAGGA
GAAGAGGCGGCAGAAGAGGCTACAGGAGGTAGAGAAGCAATTAAATGAGG
TTGCGGAGGAAATAGTCGAAGGGATGATTTGCAAGTTTGAGAGTAAAAGG
TTTATTAGGGGAGCATACTTCATTTGCGTCCAACTCCTAGCAAGGACCTA
CCACCGTGGAATCCACGTCTCGACACTATAAATCCAAAACCTGCGAGAAA
CTGCCAAATTAGCTGCGGCGCGCAAGCAATCGCTCATCTTCCTCCCATGT
CATCGCTCCCACATAGACTACGTCTCGCTGCAGGTGATCTGTTATCGGCT
CGGTCTGACCCTTCCAGTAGTGGTGGCAGGGGACAACCTTAATTTTCCCC
TTGTTGGTCCATTCCTCCAACACGCAGGGGCAATGTTCATAAGGCGCTCA
TTCAGTGGCGACGAGGTGTACACCGCTATTGTTCAAGCATATGTCGATGC
ACTACTATCTGGCGGGTACAACTTTGAATGCTTTAT

Sequences in the Contig:

SY0AAA9YJ09FM1