Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YI10FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00000554001 E-value : 9e-70
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 108 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAA9YI10FM1
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCGTGTC
GTCTCTCTTCTCTTCTCTCACTCAACCCTCTAGCTCCTTCGCTTTCCACT
CACAACCTTAACACTCTCTTCTCCTTCGCACGATATCATACACACACGAC
TACGGCATACATATCGCAGCGCAGCGCGGCCTCCCTATCAAACCATCATC
CCTGCGTATTTCCTCCCGACGGCGCCTCCCCCGGATTTTTCTCCTTTGAG
CCTCACTCACGAGTCGAGCTGCTGCGCCCCACTGGAATCTCAACATCTAA
CTTATTGCCTCCCTAACACAAATACCATCCGCACCTTTCCCCATTTCTCT
ATCTCTCGAAGATCGACATTTGTGTCGGTTTCGTTTCCCGATACGCTCAA
AAATTCCAAATTCTCGACAAAGTTCCTTACCTAGACCAGATGCCTATGAA
GGCCGAAGAACTGAAAAATAAGGGGAACGTGTGCTATGCCGAGGGGGATT
ATGTCGGTGCGGAGAAATTTTATACTCAAGCAATTATAAAAGACTCTACG
AATGCCGCTTTCTTCACTAAT

Sequences in the Contig:

SY0AAA9YI10FM1