Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YG01FM1
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00002163001 E-value : 1e-172
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12912
Accession: ref|XP_001548517.1| Score: 415 E_value: 3e-39
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03663 Score: 307 E_value: 5e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O74383|YNV8_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAA9YG01FM1
TTGGACAAAACAATGCCTGGAGCAGCAGCCAACACCGGAAAGTCCGTCCT
GAAGCAGGGTGCGAAACGTGATCCCGAACTTTATGTATGAGAATTCTTCT
GTTCATTTGAGCCTCACTTCGCCCCCCATCTCTCCGGTTATTAGGTAGCT
GGAAACTAACATGGTGATGGGTACAAGATCCTCCTCGCCGTAATGTCCGG
TGCTTTTGGACTTGCGGGTTTTTACTTCGGACGGAAGCCTACCTCGGCAA
CATCCGAAGAAGGCCGTATCAATGTTGCCAAGGATGGAATGCCATGGCAT
AATGAGTCGACCGAGACTTCTGCTAGGGATCACTTCAAGTATAAGTACCA
TCCCGGTGGAGACGCCAGGAACCCGCCCAAGGATGCCCCAAGCGCTTTGC
ACTCTGTTGTCATTCCCAGCGTCAACTTGCCAAAGGAACTTCACGATAAG
TACAACAAGTGGGGCAAGGACGGATACTAAACCATTATATCACTCCGGCA
TGAGCTGCTAGTCCTTGCTAGTGGCGTATTTTTTTTCTCTCTTGTATACC
AAAATTGGTGCGTGGGATTGTATAGAGT

Sequences in the Contig:

SY0AAA9YG01FM1