Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YD21FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00008748001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG00904.1
Accession: ref|XP_381080.1| Score: 202 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG00904.1 Score: 202 E_value: 8e-15
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3370 Score: 171 E_value: 2e-13
PFAM Definition: dUTPase, dUTPase. dUTPase hydrolyses dUTP to dUMP and pyrophosphate..
Pfam Number: pfam00692 Score: 108 E_value: 4e-06
Swissprot: Q6MVL2|DUT_NEUCR
Gene Ontology:
GO:0004170 = Molecular function: dUTP diphosphatase activity

Sequence:
>SY0AAA9YD21FM1
TTGGATTCAACCGCACCAACCAATACCACAAACATTCTTTAAAAATTTAA
AGAAATTAAATTATCACCATGACTCAGGAAGAACCTGTCCCCGCTCCTAT
GGCTACTCCCGTCATCGCAAAGGCTCCTGTCATTGACGGTCCCCTCCCAG
ACACTATTATTACTGCCACTACCACCGCCGCTGCTGCCACTACTTCAGCC
ATCAGCGCATCCCCACGCGTCCTGAAACGCCCGTCGACCGAAGACCTTCC
TCAGTCCCCGAAGAAGCAGAAGACTGCTGACCCTGTTGCTGTTTCCACCC
CTACCATCGCAGCAAAAAAGATCCTTACTCCTTTGTCACCGGGGGAGAAG
TCAAACGCAAATCTTCGTATCAGGAGGCTTTCTTCCAAGGCTAGGATTCC
GAAGAGGGGGTCTGCGCTTGCGGCCGGGTATGACTTGTACAGTGCGCACG
ACACTGCAATTATTGCCCGTGGAAAGGCTCTCATCGACACTGATATTCAG
ATGATGATTCCGGTTGGGACTTGTGTGTCCCCTTCTTCACCTGGGTGGAA
ATGGGTCACTAATTGTTTGTTTGGTAGATGGGAGAATCGCGCCCAGAA

Sequences in the Contig:

SY0AAA9YD21FM1