Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YD08FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00000288001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_14322
Accession: ref|XP_001804514.1| Score: 638 E_value: 6e-65
KEGG Definition: HEAT SHOCK 70 KD PROTEIN (HSP70)
Accession: ncr:NCU09602.1 Score: 604 E_value: 3e-61
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 588 E_value: 1e-61
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 481 E_value: 2e-49
Swissprot: O93866|HSP70_TRIRU

Sequence:
>SY0AAA9YD08FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTTGCTTGGAAAATTCGAGCTTACTGGAATCCCCCCCGCTCC
CCGTGGTGTGCCTCAAATCGAGGTCACCTTCGACATTGATGCCAACCGTA
TCTTAAACGTCTCCGCTGTTGAAAAGGGTACTGGGAAGACTAACCGCATT
ACCATCACCAACGACAAGGGCCGTCTCAGCAAGGAGGAGATCGAGCGTAT
GCTCGCGGAGGCCGAGAAGTACAAGGAGGAGGATGAGGCGGAGGCGTCAA
GAATCCAGGCCAAGAACGGACTTGAATCTTATGCTTACTCTCTCCGTAAC
ACATTGAGCGACGAGAAGGTTGAAGAGAAGCTTGATGCCGGTGACAAGGA
GAAGCTCAAGAGTGCTATCGATGACACCGTTGAATGGTTGGACAACAACA
CCACTGCTACTAAGGACGAATTCGAATCTCAGCAGAAGGAGTTGGAAGGA
GTTGCCAACCCCATCATGATGAAGTTCTACCAGAGCCAAGGTGGTGCTCC
TCCTGGAGGCATGCCAGGTGCTGGTGGCTTCCCTGGTGCTGGTGGGGCTC
CCCCATCTGGCGGTGGTGATGATGGTCCTCAGGTTGAAGAGGTGGACTAA
ATGGAAG

Sequences in the Contig:

SY0AAA9YD08FM1