Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA9YB22FM1
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00004452001 E-value : 1e-132
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Nuclear structure].
Kog Number: KOG2491 Score: 141 E_value: 7e-10
PFAM Definition: No Hit Found

Sequence:
>SY0AAA9YB22FM1
TTGGTAACAACACTGTGACAAAACATAGCGCCTCGACCTTTTCGATAATG
TCTCCAACTCTCCTCCCAAATGGAACATCTGCGTCGAAAACGGTCGATCA
GCTCTCCTCCCACCTTCGGGAGATTCTCTCCTCCGTCAATAAAACTCACC
TTGAACCCCCGTTGGTTGAATCCGATTTCGACCCTGAGATATTAGCCCGT
ATAAGATTGCTACGGTCTTCTCCGGATGAATTATACCGGAATTCTCTGGA
TACTGCATTTAAAGGGGCGCTGTATGATCTTTTGGTAAGTTTTCTGGTCT
TCTCTTTGTATGCTCTGCTCACTGCGCCGCGATAGACCAATAACGGCGCT
ATCGATACCACAACCCTTCCCGTCTTCTGCAACTTCTTAGATCTTTCGTT
AGTTTTAGCTGAGCTAGGTATGTTCACCTTTATCCTCCTTCCAGACCTTC
TCTTACTCTACCACAGAAATATCTGGCGCAGGTTTACCGCTTGATCTTAT
TGAAGAGCTCTTTGACTCACAAACTATACCATCATGCGAGTGCCTCTTCC
AATATTTGGAGTCGCGTATCGATAGGGTTACTGCAGGAGTTGAAGGTGGG
AAGGGGAAAGCCCTCATATTGTTGCGGCTGTGCAACGAGCTTCTCAAGAG
ACTATCGAAAACA

Sequences in the Contig:

SY0AAA9YB22FM1