Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YP22FM1
Length(NT) : 519
Best Gene Model Blast : Link to GSTUMT00007105001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG06102.1
Accession: ref|XP_386278.1| Score: 286 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: fgr:FG06102.1 Score: 286 E_value: 1e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YP22FM1
TTGGACGGCAACGACAGCTGGCTCAAGCAACATGGAATCTGTGCTCAAAA
GCCCCTTTCCTGCCTCTACCAAGCGGGCGACCTCTGTGATCGATGGAATT
TCCACTGAATCAACCGTGGTTTACTTTGCTGATAAGATAATGATTACTCT
AAGCCAAGACGGCAGGCTTGCTCAGTGGTTTCATGTACCGTTGGATACCA
ACAATTCAGCACTCATCGGGGCTCAATCGGCTGAAGACGAAGATGGTCTA
CTCCCACTTACCCACTTAACACCCACCACATTACTTGGCGGAGCGGTCGA
ATCAAGAGAAGCGTTAGGGCAATTGATCGCAGTCCAGCTTGCTTCAGCCG
TATCCATGAGAAACAGGGATGAAGGAAGGATGGTAGTTTTAGGACTGGGA
CTGATGAAGGCGGAACTAGAGAGGGACGCGTTCATCCAACTCATCGAGCT
GGTTGGAAAGTGTCTATAATATTTAAATAAGTCCGATCTGCTAGAACAAT
TGCTCGCTTGAGTGTTTTC

Sequences in the Contig:

SY0AAA8YP22FM1