Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YN15FM1
Length(NT) : 537
Best Gene Model Blast : Link to GSTUMT00003290001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1288.2
Accession: ref|XP_658892.1| Score: 200 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: ani:AN1288.2 Score: 200 E_value: 1e-14
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Translation, ribosomal structure and biogenesis].
Kog Number: KOG2590 Score: 135 E_value: 3e-09
PFAM Definition: La, La domain. This presumed domain is found at the N-terminus of La RNA-binding proteins as well as other proteins. The function of this region is uncertain..
Pfam Number: pfam05383 Score: 155 E_value: 1e-11
Swissprot: Q6ZQ58|LARP1_MOUSE

Sequence:
>SY0AAA8YN15FM1
ACTCAACTGCTGAAGGGGGCTCTTCGCATCCTCCGCGCGAGAGAGGAATG
GAGCCCCGCGGGCGCGGCGGCCACAGGGGGCGGAACGGAAGCTTCTATGG
TTCACAATATTCAAATAATCACCACAACGGTGGTCATCATGCCGGTTCCG
GCTCTTATAACTCTACACCCCAAAATTTCCACCCGGGCCATACCAATGGC
CAGTATTCGTCTCAGAATCCACAGGCATCGGGCAGATCATACAGGGGTTC
CTCGAGAGCGCACTCACTGCCAAATACGGCAGTCTACAACAGGTTTCCAA
ATCCCCATATGCAGTCACCGCCATTCGTGCCTTTCCAGGTGCCCTATGGA
TTTGAAATGGTGCCACCGGGCGAGGCTCCAATGGTGGGTATTGCATTCCC
ACCGTTGCCAGAAATTACCAATCAGATCAATTACTACTTTTCGGTTGATA
ACCTTTGCAAGGATATGTATCTACGAAAGCATATGGATAACGAGGGTTTT
GTTGCATTGTCGTTCATTGCAAACTTTAACCGAGTCA

Sequences in the Contig:

SY0AAA8YN15FM1