Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YM24FM1
Length(NT) : 161
Best Gene Model Blast : Link to GSTUMT00001750001 E-value : 4e-63
Numbers of ESTs : 1

Blast Results:

Nr Definition: glyceraldehyde 3-phosphate dehydrogenase
Accession: gb|AAT76626.1| Score: 124 E_value: 2e-12
KEGG Definition: hypothetical protein [EC:1.2.1.12]; K00134 glyceraldehyde 3-phosphate dehydrogenase
Accession: ani:AN8041.2 Score: 112 E_value: 4e-11
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 101 E_value: 8e-06
PFAM Definition: No Hit Found
Swissprot: Q96UF1|G3P3_RHIRA

Sequence:
>SY0AAA8YM24FM1
TGTCAATGGAAAGACTATCAGGATGTACTCCGAGAGGGACCCTGCCAATA
TCCCATGGGGAGCTGCTGGAAGGTTATCATTTTGGCTCCTTCTGCCGACG
CTCCCATGTTCGTTGTTGGTGTAAACTTGGATAAATATAACAAAGACATT
ACTGTTCTCTC

Sequences in the Contig:

SY0AAA8YM24FM1