Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YM03FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00009033001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: enoyl-CoA hydratase
Accession: ref|XP_001260542.1| Score: 270 E_value: 3e-22
KEGG Definition: enoyl-CoA hydratase [EC:4.2.1.-]; K01726
Accession: afm:AFUA_2G10650 Score: 252 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YM03FM1
TGTACAAAAAGTTGGACTGCTCGCTGAGGCAACGACCATATCCATGTTGG
CCAGCATCTCCATTCCCCCGCCGAGTGCAAGCCCGTCGACAGCGGCTATC
ACGGGCTTTTTCCCGCTGCGCCGGGAGAGGCCGCCAAAGCCGCCTTGCGG
GTGGGCGACGATGGGGTCAGCGCCGCCGGATTGAGCGTCGTTCCATTCTG
TTCTCGTCAACTATGTCCCGCAATATACAGGTTGCGGGCGTGAGATGGAC
CTTTCAAGTCCTGACCTGCGCAGAAAGCTTTCCTCTTGCCTTGGGGATTT
CCAGTGACCACTGGCGCAGCGGAGTGATGGTTCATCGTCGTACCAGGGCC
ATACCCGTGACATCTCGTTGTGGGTTTGGGTGTCTACGCAGTTCATTGCC
TGCGGGCGATTGATCGTCACCACAAGGATATGGAGCGATGGGAAGCTTAA
GATGAGGTTCTCTGCCGGGGGTGGTGGCGTGCGGAGCATTTTTGGTTTGA
GTATTATGTTGTGAAGTGCTATGTGGTTTTTTTTCCATTGACACAACGGT
TGGGGGACCGTGATTTTGTTGTACTCGAGTAGGTTGGCGGACCGGGAGAT
ACCGGGACTAATAACGAGTACTAGTACAAACCGGCA

Sequences in the Contig:

SY0AAA8YM03FM1