Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YL21FM1
Length(NT) : 456
Best Gene Model Blast : Link to GSTUMT00007557001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP-dependent RNA helicase HAS1
Accession: sp|A4R8B5|HAS1_MAGGR Score: 332 E_value: 1e-36
KEGG Definition: conserved hypothetical protein [EC:3.6.1.-]; K01529
Accession: mgr:MGG_06522 Score: 332 E_value: 6e-37
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0342 Score: 240 E_value: 1e-21
PFAM Definition: No Hit Found
Swissprot: A4R8B5|HAS1_MAGGR

Sequence:
>SY0AAA8YL21FM1
TTGGGCCGCACAACTTTGTACAAGAAAGTTGGCTTTCTAAAGTATCTCAA
AGAGGCTCGTGTTCCGGTCGTCGAATTCGAATTCCCAGCGAAGAAGCTGG
GTAAATGTTCAATCTCAATTGGAAAAGTTAATTGGGAAGAACTACTACTT
GAACGGAAGTGCGAAGGACGGGTACAAATCGTACCTCCAGGCCTACGCCT
CTCATTCCCTCCGCACAGTCTTTGACGTGCACAAACTCGACCTCGTCAAA
GTTGCCAAAAGCTTCGGCTTTTCGACACCTCCAAAGGTGGATATTCAATT
AGGGTCCGCGCGGGATAAACGGCCGTCACAGAGGAGGAGTTACGGCCCGA
GGAGCGGGGGTGTGAAGAGGCGGAGAGATGGTTAATTGGTTTGGGGGTGT
AGCGAGGGGAATTGGGAGTGTAGGATATGTTATTGGGTTGAAATTTGTAC
GATAGT

Sequences in the Contig:

SY0AAA8YL21FM1