Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YK06FM1
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00002231001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_01063
Accession: ref|XP_368181.2| Score: 181 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01063 Score: 181 E_value: 3e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YK06FM1
TTGGAGGATATCATCTTGGAGAATGAAAAATCCAATAGCGAACTTAGAGC
TACTATTGCCACCTTCCAGGGCACCGCTGAAGGTCGAGATGCGGCTCTTG
AGAAGCGTGTTTTACAGCTCCAAGGGAAGTTGGAAGACCAGAGGGAAAAG
ATGTTCAAGGCTCGCGAGCATATCAAAAAGCAGAATGTCATTATCAGGGA
CCTCAAAGAGAAGGTCGACACGGCCGAATCCACTACCCCAGACGCAACCA
CAAAATCCAAGGAGGAGCAGCTCGCTGAGAGTGATAGGAAGAGACGCGCC
GAGCTCGAAATCCTCGAGAGGGAGAACAAAATGATCGCGTCAGCCTGGTA
CGACCAGGCCACTAGACTGCAGATGAACAGCGTCGCGCTCGAGAGGAAAG
GCGATACACCACATAGTTGGTTGAACAGGCAACGCGCTGCCTTGGCCAAA
GCTGGCGGCGTCTAACCAAAATTTAATTAAGTGATGAGAAGCTGAGTATG
ATGATAACATGTGCGTGTACTGTGATCAACTTTTTAATCAAGTCCTACCG
ATTACGATACGATAATAGAATTCAAAGTCTCATGTGGCGTTTCTGTTCTG
TTCTGTAGAAGATTTGTCGAATTTCCCTTCCTTACAAATCATGTTCTCCT
TTTTTTGCTTGATCACCCGCTCCCCCC

Sequences in the Contig:

SY0AAA8YK06FM1