Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YJ09FM1
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00002361001 E-value : 1e-140
Numbers of ESTs : 1

Blast Results:

Nr Definition: GIY COI i6 grp IB protein
Accession: emb|CAA38783.1| Score: 157 E_value: 4e-09
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YJ09FM1
TTGGTGTAGATTTAGCTATATTTGGATTACATTTATCTGGTATAAGTTCA
CTTTTGGGTGCTATTAACTTTAGGAACATTATATGTGACATATTTGTTTT
AATGAGTTTAAAAAACTCAATAAGCGGGCCGGCCTGTATCGCCCCAGGGT
CTCGTCGTTTTAAACTGACCTTAAATAACAAAAAATGTTATTTGAGCTCT
AACAGTAGCTCAGATAATAATAATAAACCACCTAAAAAGGATAAAAATTT
TTGAAAAGAAGTTTTAGGTCGAAAGGGTTCTTCTAATAGAATATCTCATA
GATTAGCACATGAGCAAATTAAAAGTGGTCAACGTGTTACAGTGAAGATA
ATTAATGACATTTTAGCTTATTGTGGTATTAGAATTACTGAAGATATATT
CAAATCTTTATTAGCTGCACCTAGATTTGTTTTTGATAATTTAAATAAGG
ATGAAACAATAAAAATTATTAAAGATAAGATTGGGGGACCTTGAGATAAA
ATAATGTTAAAACTAAGTAATTATTCCAGTGGCTCCGAATATTTCTACCA
AGAATACCGGAAGCATCCCGTCTTTTACTTTAAAGTATCTTTAAAGACGG
GAACTAATTGATCCTAGTAACGGTAGAGTAATTATAGTTAAATATATTAT
TAATGTTCTATTTTTATGCGTA

Sequences in the Contig:

SY0AAA8YJ09FM1