Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YJ01FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00001495001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_04288
Accession: ref|XP_001594481.1| Score: 165 E_value: 4e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG05764.1 Score: 125 E_value: 9e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YJ01FM1
TTGGCGCTGGGGTTGACATAGACCAAGTAATAGAGAATGTGCTTGCCAAG
AAATGCGATGCTCTTGCTGGATGGTGGGCATTGTTAATAGAGAAGGAGGA
GAGAAAGGAGAGGAGACGGCAGAAGCGGAAGATTGAGAGTAGGAGAATGA
GTGCAGCTTCTAATCTAGATCCGACGTTGTTGCCTCTAAATGAAGAGTCG
GAGGATCAGATGAGGCGACAAAATCCTGTGATTATCTTGCCCGAGCGACA
TCATGGAAGGAATCCCAGAGCACAAACACCCCCGTCTCCCACCCCGCCTC
CGCCAGTCGAGAAGGATAGGGATTATGGACCGTACTTGAAGCCGCCGCAG
CAAGATAGGCAAGTTATGTCGTCCCCGGATCTTCACTCGGAGGTGAATGG
CGGGAAAGGGAGGCAGAATAGGAAACATGCTCTAATGACCCAACTTGCGT
CTTTAAAGCATTGGTTTCTGGATTCAGCCAAAAGGGCGACTTCTCCAAAT
TCCAAAAACAGCTCGAACCATAATTCGGCGAGCCACAATGCCAGCCACGG
CTATCAGCCATTTCAAAATGGACTGGGTTCACGTTCGGGGAACGGCGCGC
GGAGGAATTCGAGGGGAAACGTAGCGTATAATTCTAGCTACCGTGGGACC
CCACCAC

Sequences in the Contig:

SY0AAA8YJ01FM1