Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YH06FM1
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00003749001 E-value : 1e-112
Numbers of ESTs : 1

Blast Results:

Nr Definition: SMT3
Accession: gb|AAZ22337.1| Score: 366 E_value: 2e-33
KEGG Definition: hypothetical protein
Accession: ani:AN1191.2 Score: 271 E_value: 1e-22
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1769 Score: 248 E_value: 3e-22
PFAM Definition: No Hit Found
Swissprot: Q12306|SMT3_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005940 = Cellular component: septin ring
GO:0005515 = Molecular function: protein binding
GO:0031386 = Molecular function: protein tag
GO:0016925 = Biological process: protein sumoylation

Sequence:
>SY0AAA8YH06FM1
TTGGCAACCTTTGCTCACCGTCCACTCTCACGGAACCTGACCTCGCTCCA
CCAATCCATCGCGTCAGTCCCCAAACTTCGAACGAACACGCTTTAAACCA
TGTCGACAGATGCACCAAACGACCCCAAGCCGGAGGAAACCGCCAGCGAA
CACTTGAATATCAAGGTTACCGATGGCAACAATGAGGTTTTTTTCAAGAT
CAAGAGAACCACTCAGCTCAAAAAGTTGATGGATGCTTTTTGCGATCGTC
AGGGGAAGGCCCCCAATTCAGTGAGATTCCTCTTTGACGGAACTCGCGTC
CAGGGCGGGGATTCGCCTGAGAGTGTAGGTCTCTTTTTTAAAAAATTTGA
TCCTATTTCCCCTCTCTTACCCCAGTTTCTTATTCGTATCTCTTATCATA
CCCACCTCTATTCCATTCCAGTGGCGACCTTATCATCGTTCTGGGACGAG
GGGGCAATTTTCTAAGATTCCTTGATTCTGCTCTTTTTTATTTCCTCTCA
CTGGTCACTTACTTCCTTGCCTTTGGCCTTTGAGATTCTTGAATCTTGCC
AGATCACACCCTTCTTCTCCAATTTACCCCACGCCCCTATTTCCCTGTTA
TGCCCGATATTACCGACACCCCACTAATGGATATGCAGCTCGATATGCAA
GATGGAGATACACTTGAGGTTCACCAAGAGCAAATCG

Sequences in the Contig:

SY0AAA8YH06FM1