Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YH05FM1
Length(NT) : 671
Best Gene Model Blast : Link to GSTUMT00010963001 E-value : 1e-173
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1676 Score: 121 E_value: 2e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAA8YH05FM1
TTGGCAAAAGCACCCCACTATTGGCCAATACAGACCCTCTCGCCCACCAG
GCCTTCCATTAGCCCAATTTCTTCTTTACTACAAGAGTCATGGCTTACAA
TTACGATTATGATTACACCCAGCTCGCAAGCAAAATGGCAGCTGCCCAAA
CACAGGGTGCCCCACCTCCTGGTGGTGCCCCTCCATACCAACAACCATAT
GGCCAACCGGCACAGCAACCGGGGCAATACCCCGGATATCCCCCGGCCGG
TGCTTCCCCCCAAGGCCCGGCTTATGCTCAACAGCAATATCAACCTTATG
TAACTTCATCCTCTTGTATCTACTTCTCCCTCATTCTCCTACTTACTACT
TATCCCGCTTCGGCAGCAAGGATATCCACCCCAAGGTCAACCTCCGCATG
GACAACCTCCCTATGGTCAGGCTCCTTATGCCGGTGCTCCTCCATATGGA
CAAAGTCCAGCACCAGGTTACGGAGCTCCACCTTCAGGCCCTCCTCCAGA
TGCCAATATTCTTTTGAGCATTCTCAGGGAAGCAGTAAAGGAAAAAGGTA
TCGAGAACATGTACCCGGAAAACAGGCTTGTCGGCATTGCAAATGACATG
GCCAAGAAGGACCCCGTCAATGCCTTATGTAATCATTGGAAATTGCCGAA
GGAGATTGGGTTCGACTTTGT

Sequences in the Contig:

SY0AAA8YH05FM1