Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YF18FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00007884001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An02g10560
Accession: ref|XP_001400185.1| Score: 195 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 195 E_value: 5e-14
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 150 E_value: 5e-11
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAA8YF18FM1
TTGGGTGGTTAAAATACTGCTTGGACGGGACGATGTCAACCCCGACAAAA
TAGACGATGACGGCCAAACACCACTCTGCTGTGCTGCTTGGAATGGGCAC
GAGGGAGTGGTGAAAATACTGCTCGGGCGGGACAACGTCCACCCCGACAA
ACCAGATAATGGCGGCAAAACACCACTCCAGTTGGCCACTGCGCGTGGCC
ATGCGGGCGTCGTAGCACTACTACAGCCAGCATCTACTGGCCCCAGCACT
ACCTAGGACCGTGGAGGCACCGCCCTCATGGCCCCTTCGAATACGGATAA
CCTATGTTCCATTTTCGCGAGGACCTCAAGAGCCCCATAAATATCTCTCT
CGCCACCACTGCCTCCCCCCCACTCCCGACCAATCTCCTCCTGTTTGGAT
CCAAATTCTACCTTGTAGTAGTTGTTTTCTTTTCCTTCGAGACTAACCCT
GCCAGGGGGGCTCAGCTCAAATACCTCCTTCTGGTTGCGGGAAATCCCAT
GCAATGCAAGTGTAAATGTCTGCCACGTACCCACCCAAACCTTTAGAGAG
ATTATGTTACCGGTGTGTGGTGA

Sequences in the Contig:

SY0AAA8YF18FM1