Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YD06FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00000963001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03662
Accession: ref|XP_001244221.1| Score: 252 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: ani:AN2887.2 Score: 224 E_value: 2e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q5B993|ATG11_EMENI
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>SY0AAA8YD06FM1
TTGGCGCTGTTGCGGCAAAAGGTTTGGCGCAGCAGTTTGAGAAAGAGGTC
ACTGATCTTGGGGGTACTATTGAGGAGATTTGCGCTAGGACGGCGGATCT
TAAGAGTGATATTCAGAAGGCGAGGACATCAAGACCACGCAATGTCCTCG
AAGAGATGAAGAACCTGTTGGGCGAGATTGATATCTTGGTCAAAAAAATT
AGAACGGACTATGAGTACGTTCAAAGTTTACAGGGCCCGAAATCGGTTTC
TACAGCTTCAAAGCGAGCATACGCATCCACCACGGATTATCTCCCTGGCC
TGGCCAATATTGTTAATGATATGGGCCGATTATTACAAATAGCGGTTAAA
CAGAAGAACGAGATTAGTGCAACAAGTGTAAGGCAGCTTCAGATAGTCGC
TTTTGTACAATCACTCTCCGCTCCCGTAAATCCTCAAATCCAGAAGATGG
ACTCGGCATATCAAGAAGAAGACGAGCACCCTCGATTACTCTCTCTGGTC
GTTCGGTTCCCCAAGATCTACGGAGCTCTGCTCGTTGAATGTGTGCGGCG
AAGGGAATGGTCGGAGAAGTTTGCCAATGATAGCAAGAGGATAGCTGAGG
AATT

Sequences in the Contig:

SY0AAA8YD06FM1