Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA8YB20FM1
Length(NT) : 635
Best Gene Model Blast : Link to GSTUMT00008586001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG00667.1
Accession: ref|XP_380843.1| Score: 588 E_value: 3e-59
KEGG Definition: hypothetical protein
Accession: fgr:FG00667.1 Score: 588 E_value: 2e-59
KOG Definition:
Classification: [Chromatin structure and dynamics, Replication, recombination and repair].
Kog Number: KOG1009 Score: 423 E_value: 1e-42
PFAM Definition: No Hit Found
Swissprot: O13985|YEG3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA8YB20FM1
TTGGTGTTTGTTCAAAACATACAGACCAATTTCCTTCGAAAAATTCTCTA
AAAATTTCGGGAATAAAAAATAACCACAACCTCTCCCTCCCCACCCATTG
GCAGTTGGAGCACTTGTTTTGCTTCTGGTCAACCTGCTCCAAACGCCTTC
CTTCCGTCGTAGCTCTTGGACCTCTGAAGGAACGGCAACATGAAGGCTAT
CCCACTTACCATTCACTGGCACGAACAGAATCAGCCAATATACAGTGCAC
ATTTCGAGCCCAACGGGAAAGGTCGGCTTGCGACCGCCGGCGGGGACACT
AATGTTCGAATCTGGAGGGTCCAAGGTGATGGCGAGGAGAGCAAGGTTGT
CTACCTGAGTACTCTTGCGAAGCATAGCCAAGCCGTTAATGTTGTTCGCT
TTTGTCCACGAGGTGAGATGCTTGCATCGGCGGGCGATGACGGTAATATC
ATACTCTGGGTTCCCGCAGAGCCTGGTCACCGTTCTGGTGCATTTAGCGA
CGATGATCTCGAGGACAAGGAGACCTGGAGACTTAAACATATGTGTAGAT
CGATGGGCTCGGAGATCTACGATCTTGCCTGGTCCCCGGATGGTATATTT
TTTATCACCGGAAGCATGGATAATATTGCCCGTGT

Sequences in the Contig:

SY0AAA8YB20FM1