Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YN23FM1
Length(NT) : 434
Best Gene Model Blast : Link to GSTUMT00004443001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: putative squalene synthetase
Accession: gb|ABD66601.1| Score: 672 E_value: 3e-69
KEGG Definition: squalene synthetase [EC:2.5.1.21]; K00801 farnesyl-diphosphate farnesyltransferase
Accession: aor:AO090010000204 Score: 470 E_value: 4e-46
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1459 Score: 381 E_value: 5e-38
PFAM Definition: SQS_PSY, Squalene/phytoene synthase..
Pfam Number: pfam00494 Score: 202 E_value: 3e-17
Swissprot: Q7S4Z6|FDFT_NEUCR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAA7YN23FM1
TTGGGAGTCTCTCACCCTGCGAAGATGTTTTGAGTTCTTGGATCTCACAT
CGCGGTCTTTCAGTGCTGTTATTCAAGAGCTGTGCCCTGAGCTTTGCGTC
TCGGTGACACTCTTCTACCTTATCCTTCGTGGTCTCGACACCATCGAGGA
TGACATGACCATTCCACTAGAAATTAAGGAGCCCCTTTTGCGCTCTTTTG
ACAAAGTTCTCGACAAAGAGGGGTGGACTTTTGACGGTAATGGGCCCAAG
GAGAAGGATAAGCAGCTCCTTGTGGAGTTCAGCAATGTGATTACGGAGTT
TGCCCTATTGTCCGAGAGCCATCGGGCGATTATTAAGGACATTACCAAGA
AGATGGGGAACGGGATGGCCGACTACGCTAACAATGCCGAGCATAATGTT
AACGGAGTCAACACAATCGCTGATTACGACCTGT

Sequences in the Contig:

SY0AAA7YN23FM1