Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YN11FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00000665001 E-value : 1e-63
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NEMVEDRAFT_v1g155763
Accession: ref|XP_001618098.1| Score: 171 E_value: 8e-22
KEGG Definition: NEMVEDRAFT_v1g155763; hypothetical protein
Accession: nve:NEMVE_v1g155763 Score: 171 E_value: 4e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA7YN11FM1
ATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATC
AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATG
GAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAAC
TAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCACCGCC
ACCGTAGAAACGATACGGTGGCGAGTAGGCAGGCGTGGAGGTCAGTGACG
AAGCCTTGGGAGTGATCCCGGGTTGAACGGCCTCTAGTGCAGATCTTGGT
GGTAGTAGCAAATACTCAAATGAGAACTTTGAGGACTGAAGTGGGGAAAG
GTTCCATGTGAACAGCAGTTGGACATGGGTTAGTCGATCCTAAGACATAG
GGAAATTCCGTTTCAAAGTGTGCAGTTTGCATCACCTGTCGAAAGGGAAG
CCGGTTAAAATTCCGGTCAAGAATGGTACTGAGTATACTACCACTGAGGT
TGTCACCTCTTATACCACCTACTGCCCGTTGCCCACTACCATTGTGGAGA
ATAACAAGACCTACACTGTCACCAAGGCCACCACTTTGACCATCACCAAC
TGCCCTTGCACCCGCACCAAGGTCTACACCACCATCCTCC

Sequences in the Contig:

SY0AAA7YN11FM1