Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YN02FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00006100001 E-value : 1e-157
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN8855.2
Accession: ref|XP_682124.1| Score: 141 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: ani:AN8855.2 Score: 141 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA7YN02FM1
TTCAACAAATACCCCAACAGCTCACTTCAATTTCCTTCAATGACGCGGGT
GAGGAAGAAGACGAAAAAGACCGGGTCGATCTTGTTGTCCAGACATCGCG
GTTTGCGAGGTGGTGGGCCATCAGTCATAGCTTCAAGGCCTTTTTCCAAC
ACGTCATCTTTATCGTCAAAGGTCGGAAGGACTCTCATTCGGAGTCATCA
CACTTTGCAAAAGAGGCTCTCGCAGGCTCTGTCCAAAAATGATACCGAAA
CTGCAAACTCTATCCGAGCGGAGATCGAGGCAAACGGTGGGATTGAAAGG
TATCAGCAGGCAAGCGTGCGTCCATCACCATCATTGCCCCTGGAATTCTT
GTTCAACCCTTTTTTTTCGCTTATGCGTGTGATGTGATGTGATGGTCGTG
GTGTGTACTTGTTAGCTGCCGATGGGGGGGTACGGTGTTGAGAGCTTGAT
GAGTAAAGTGGCGAGCGTGGAAGGGTAAAAAAAAAAAAAAAGAGACGAAC
GCTTGAACTGAATTATGTGTTTCATTTACAATAGGTGTGCGGTCAAGATA
ACCAACGAGGAGGGGATTCCTCAAAAGTATTGATCGACTGGTTAAGGGAA
ACCATTCGATCATCGCCAAATAAAAAGGTCACGAACAAAAAGCTACGACT
CCTTGAGGTGGGGGCTCT

Sequences in the Contig:

SY0AAA7YN02FM1