Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YM02FM1
Length(NT) : 707
Best Gene Model Blast : Link to GSTUMT00006586001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 513 E_value: 2e-50
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 504 E_value: 1e-49
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 302 E_value: 2e-28
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAA7YM02FM1
TTGGCCAACTTTTTGTACAAAGTTGTCCCCCGATCCTAATTTACCGGATA
TGCATGGCCAAACACTCTTGTCGCTTGCTGCTGGGCAGGGAGAGGAGGAA
CTTGTGAAGCTATTTCTGGAGCGCAGTGATGTTAATCCCAATTCACTAGA
TGGTAATGACCGAACACCCCTATCATCTGCCGCCTCCAGTGGATATGAAG
GGGCAGTGGGGCTACTTCTGGAACACCGGGATGTCAAACCAAATTCGCCG
GACAAAGGTGGCCGGACACCTCTATCTCTTGCTGCCTCTAGAGGATATGA
AGGTGTAGTTAACTTACTTCTGGAACGCAGGGATATCGACCCCGATTTAG
TCGATAAGAATGGTCGAACGCCCCTGTCATTTGCTGCCTCAGGAGGACAT
AAAGGAATAGTAAAGCTACTTGTGCAACGCCAGGATGTCAACCCCAATTC
ATTAGATGACAATGGCCGAACACCCCTATCATTTGCTGCCGAGCGCCGGC
ATCAACATGTAGTGAGACTACTCCTAGAAAGCGAAGATATCGATCCCAAT
TCCGCGGATAAGAGTGGCCGGACCCCCTTAGCACTTGCTGTCTCGAGAGG
ACATGAATGTATAGTGAGGCTACTTCTGGAACGCCGGGATGTCGATCCCA
ATTCGTTAGATAGTTGCGGCCGAACGCCCATATCATCTACTTCTGGTGAG
TGGGAGC

Sequences in the Contig:

SY0AAA7YM02FM1