Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YJ21FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00004130001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_09980
Accession: ref|XP_001227907.1| Score: 257 E_value: 8e-21
KEGG Definition: ankyrin repeat
Accession: aor:AO090103000097 Score: 240 E_value: 4e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA7YJ21FM1
TTGGTTCAAAACGGTTAAAAATGTCTTTTAGCAATAACATTAACTCTTTC
AATATCATTATTAACTGTACTGCCCCCGATGATGAGTCTAAAATACTCGC
GTGGTTGTCTCCGTTGGAGCCATGGGCTCGGCATCGAGACATCGGATCCC
GGCGGATGGATAGTGTAGGGGGCTGGCTGCTGGAAACCAGGGAATTCAGA
CGTTGGAATAATGGCAGCAGCGAGGATGAACTTAATCATGCGACCTTATT
CTGCGATGGAAATCCGGGCGTGGGGAAGAGCTCTATGATCTCTCTGGTTA
TAGACAAGTTGTGTGACGATGCTGTGAGGGAAGATACAGCAGTTACTTGC
TTTTACTTCGACTTTGCTTCCCGGAATGAGCAATCACCAATAAATATGCT
CGGCTCCCTTCTGCGACAGCTTGTTAGCGGGTTGGGGGGCATTCCGGAAG
CGGTAGTCCGAGGTTACCGAGATCAGCAAAAGGTTATTGGGGGTAGAAGA
CTACAAGTTTCCGGAATATTGGAGACGTTCCAGGCCATCGCAGCTAGAAA
GCGCACGTTTATATGTGTTGATGCAGTTGACGAATGTGCGCCAGAAAATC
GGATGATTGTTCTTGAAGCGCTAGGA

Sequences in the Contig:

SY0AAA7YJ21FM1