Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YG07FM1
Length(NT) : 675
Best Gene Model Blast : Link to GSTUMT00010757001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10144
Accession: ref|XP_001551229.1| Score: 582 E_value: 2e-58
KEGG Definition: predicted importin 9
Accession: aor:AO090012000225 Score: 578 E_value: 3e-58
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, Nuclear structure].
Kog Number: KOG2274 Score: 361 E_value: 2e-35
PFAM Definition: No Hit Found
Swissprot: Q91YE6|IPO9_MOUSE
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042393 = Molecular function: histone binding
GO:0008565 = Molecular function: protein transporter activity
GO:0008536 = Molecular function: Ran GTPase binding
GO:0006606 = Biological process: protein import into nucleus

Sequence:
>SY0AAA7YG07FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCGAAGTGCTGCAAGCTGG
ATGTGAGGCTTTCAAGGAGATCGTCAAGCATGACATCAAGCAGTTCCTCG
AATGGCATGACGGGAATGGGAAATCTGCGCTCGAGGTTTCCCTCATTATA
ATCGACAGATTGCTGAGGCCAGAAATTGCCGAGGGTTCTGCTCTTGAAGT
TGGAGGACTGGCAGCGGAGATCGTGGAAAAGGCTGGTGATCATCTTGGTC
CATATCTTCCCGAGTTACTTGGCGCGGTTGCACGCCGTCTAGCTACTGCG
AAAACCCCATCTTTCATCCAGAGCTTGATTTTAGTATTTGCACGTCTCGT
TCTTAAGCAAGCAAAAGATGTGGTGGAATTCCTCGCAGGGCTCTCCATTG
GAGATAGCAACGGGCTGCAGGTCGTCATCAATGCATGGCTCGCCAATTCC
AGTATCTTTAGTGGATATGAAGAGATTCGCCAAAATGTTTTCGCCTTGTG
CCAACTTTACCGGTTGGAGGACCCAAGGCTCTCACAGATTATGGTTCAGG
GTGATTTGATCGTACCGGAGAGCAATCCACCTGATCAGTACACTAGCGTC
CCGGTGCCCGTCAAAATCATCAAACTCTTGATACTAGAATTAGGATCGGG
AGGTGGCGATCCTGGTGCTTCTTTC

Sequences in the Contig:

SY0AAA7YG07FM1